Dependence of evolution of Cyanobacteria superiority on temperature and nutrient use efficiency in a meso-eutrophic plateau lake.

Algal blooms in lakes have been a challenging environmental issue globally under the dual influence of human activity and climate change. Considerable progress has been made in the study of phytoplankton dynamics in lakes; The long-term in situ evolution of dominant bloom-forming cyanobacteria in meso-eutrophic plateau lakes, however, lacks systematic research. Here, the monthly parameters from 12 sampling sites during the period of 1997-2022 were utilized to investigate the underlying mechanisms driving the superiority of bloom-forming cyanobacteria in Erhai, a representative meso-eutrophic plateau lake. The findings indicate that global warming will intensify the risk of cynaobacteria blooms, prolong Microcystis blooms in autumn to winter or even into the following year, and increase the superiority of filamentous Planktothrix and Cylindrospermum in summer and autumn. High RUETN (1.52 Biomass/TN, 0.95-3.04 times higher than other species) under N limitation (TN < 0.5 mg/L, TN/TP < 22.6) in the meso-eutrophic Lake Erhai facilitates the superiority of Dolichospermum. High RUETP (43.8 Biomass/TP, 2.1-10.2 times higher than others) in TP of 0.03-0.05 mg/L promotes the superiority of Planktothrix and Cylindrospermum. We provided a novel insight into the formation of Planktothrix and Cylindrospermum superiority in meso-eutrophic plateau lake with low TP (0.005-0.07 mg/L), which is mainly influenced by warming, high RUETP and their vertical migration characteristics. Therefore, we posit that although the obvious improvement of lake water quality is not directly proportional to the control efficacy of cyanobacterial blooms, the evolutionary shift in cyanobacteria population structure from Microcystis, which thrives under high nitrogen and phosphorus conditions, to filamentous cyanobacteria adapted to low nitrogen and phosphorus levels may serve as a significant indicator of water quality amelioration. Therefore, we suggest that the risk of filamentous cyanobacteria blooms in the meso-eutrophic plateau lake should be given attention, particularly in light of improving water quality and global warming, to ensure drinking water safety.

Pan-cancer analysis of ARFs family and ARF5 promoted the progression of hepatocellular carcinoma.

Background: ARF family proteins are a kind of small GTPases, which are involved in regulating a variety of basic functions of cells. In recent years, the role and molecular regulatory mechanisms of ARFs in tumor progression have received increasing attention, and research reports on most of their family members are increasing. However, research on the clinical and pathological relevance of ARF5 in cancer, especially in hepatocellular carcinoma, still needs to be improved. Methods: RNA-seq data in the Cancer Genome Atlas (TCGA) and genome tissue expression (GTEx) databases were used to analyze the expression and pathological data of ARFs family in Pan-cancer. Kaplan-Meier and Cox regression were used for prognostic analysis of ARF5 and Pan-cancer. Combined with ImmuCellAI database and TIMER2 database, the relationship between ARF5 expression and immune cell tumor infiltration in hepatocellular carcinoma (HCC) was analyzed. WGCNA is used to construct the co-expression gene network related to ARF5 expression in HCC and screen important modules and central genes. GO and KEGG path enrichment analysis were carried out for the genes in the modules with clinical significance. GSEA analysis was performed to take into account the role of genes with small differences. Finally, ceRNA network analysis was used to explore the molecular mechanism of miRNAs and lncRNAs regulating ARF5 expression. Results: ARFs family (ARF1, ARF3, ARF4, ARF5, ARF6) are generally highly expressed in Pan-cancer. ARF5 is significantly highly expressed in 29 cancers, and the high expression of ARF5 in HCC patients is significantly negatively correlated with OS, DFI, PFI and DSS, which may lead to cancer deterioration by participating in tumor immune infiltration of HCC. Through WGCNA analysis, the expression of ARF5 in HCC may be involved in many cellular processes that consume a lot of energy, such as ribosome formation, RNA and protein synthesis and lipids, as well as COVID-19, nonalcoholic fatty liver, neurodegenerative diseases and other disease pathways. Conclusion: ARFs, especially ARF5, are overexpressed in many human tumors. This study shows for the first time that ARF5 is significantly correlated with the poor prognosis of HCC patients, which may play a role as an oncogene, suggesting that ARF5 has the potential as a biomarker for the diagnosis and treatment of HCC.

TT-type resonator-based differential photoacoustic spectroscopy for trace gas detection.

A novel TT-type resonator was proposed for the first time, to our knowledge, to realize differential photoacoustic (PA) detection for trace gas measurement. The special design of the TT-type resonator allows us to install the microphone at the resonant center of the acoustic field to maximize the use of the absorption-induced PA signal. To meet the requirement of low gas consumption and easy integration, the TT-type resonator-based PA cell was fabricated as a fiber-coupled module with an inner volume of only 1.1 ml. For validation, the TT-type PA cell was integrated to a photoacoustic spectroscopy (PAS) system for acetylene detection. As a result, a linearity of 0.99999 was achieved in a concentration range from 0 to 5000 ppm with a noise equivalent sensitivity of 101 ppb. The proposed TT-type resonator contributes a new style of PA cell structure to the field of PAS gas detection, combining the advantages of easy integration, low gas consumption, differential detection, and photoacoustic enhancement together.

High-fat diet consumption promotes adolescent neurobehavioral abnormalities and hippocampal structural alterations via microglial overactivation accompanied by an elevated serum free fatty acid concentration.

Mounting evidence suggests that high-fat diet (HFD) consumption increases the risk for depression, but the neurophysiological mechanisms involved remain to be elucidated. Here, we demonstrated that HFD feeding of C57BL/6J mice during the adolescent period (from 4 to 8 weeks of age) resulted in increased depression- and anxiety-like behaviors concurrent with changes in neuronal and myelin structure in the hippocampus. Additionally, we showed that hippocampal microglia in HFD-fed mice assumed a hyperactive state concomitant with increased PSD95-positive and myelin basic protein (MBP)-positive inclusions, implicating microglia in hippocampal structural alterations induced by HFD consumption. Along with increased levels of serum free fatty acids (FFAs), abnormal deposition of lipid droplets and increased levels of HIF-1α protein (a transcription factor that has been reported to facilitate cellular lipid accumulation) within hippocampal microglia were observed in HFD-fed mice. The use of minocycline, a pharmacological suppressor of microglial overactivation, effectively attenuated neurobehavioral abnormalities and hippocampal structural alterations but barely altered lipid droplet accumulation in the hippocampal microglia of HFD-fed mice. Coadministration of triacsin C abolished the increases in lipid droplet formation, phagocytic activity, and ROS levels in primary microglia treated with serum from HFD-fed mice. In conclusion, our studies demonstrate that the adverse influence of early-life HFD consumption on behavior and hippocampal structure is attributed at least in part to microglial overactivation that is accompanied by an elevated serum FFA concentration and microglial aberrations represent a potential preventive and therapeutic target for HFD-related emotional disorders.

Pectolinarigenin ameliorates osteoporosis via enhancing Wnt signaling cascade in PPARß-dependent manner.

BACKGROUND: Osteoporosis is a prevalent metabolic bone disease in older adults. Peroxisome proliferator-activated receptor ß (PPARß), the most abundant PPAR isotype expressed in bone tissues, plays a critical role in regulating the energy metabolism of osteoblasts. However, the botanical compounds targeting PPARß for the treatment of osteoporosis remain largely unexplored. PURPOSE: To discover a potent PPARß agonist from botanical compounds, as well as to investigate the anti-osteoporosis effects and to elucidate the underlying mechanisms of the newly identified PPARß agonist. METHODS: The PPARß agonist effects of botanical compounds were screened by an in vitro luciferase reporter gene assay. The PPARß agonist effects of pectolinarigenin (PEC) in bone marrow mesenchymal stromal cells (BMSCs) were validated by Western blotting. RNA-seq transcriptome analyses were conducted to reveal the underlying osteoporosis mechanisms of PEC in BMSCs. The PPARß antagonist (GSK0660) and Wnt signaling inhibitor (XAV969) were used to explore the role of the PPARß and Wnt signaling cascade in the anti-osteoporosis effects of PEC. PEC or the PEG-PLGA nanoparticles of PEC (PEC-NP) were intraperitoneally administrated in both wild-type mice and ovariectomy-induced osteoporosis mice to examine its anti-osteoporotic effects in vivo. RESULTS: PEC, a newly identified naturally occurring PPARß agonist, significantly promotes osteogenic differentiation and up-regulates the osteogenic differentiation-related genes (Runx2, Osterix, and Bmp2) in BMSCs. RNA sequencing and functional gene enrichment analysis suggested that PEC could activate osteogenic-related signaling pathways, including Wnt and PPAR signaling pathways. Further investigations suggested that PEC could enhance Wnt/ß-catenin signaling in a PPARß-dependent manner in BMSCs. Animal tests showed that PEC-NP promoted bone mass and density, increased the bone cell matrix protein, and accelerated bone formation in wild-type mice, while PEC-NP also played a preventive role in ovariectomy-induced osteoporosis mice via maintaining the expression level of bone cell matrix protein, balancing the rate of bone formation, and slowing down bone loss. Additionally, PEC-NP did not cause any organ injury and body weight loss after long-term use (11 weeks). CONCLUSION: PEC significantly promotes bone formation and reduces bone loss in both BMSCs and ovariectomy-induced osteoporosis mice via enhancing the Wnt signaling cascade in a PPARß-dependent manner, providing a new alternative therapy for preventing estrogen deficiency-induced osteoporotic diseases.

The Constructing of the Oxide Phase Diagram for Fluoride Adsorption on La-Fe-Al: A Collaborative Study of Density Functional Calculation and Experimentation.

In recent years, fluoride pollution in water is a problem that has attracted much attention from researchers. The removal of fluoride-containing wastewater by adsorption with metal oxide as an adsorbent is the most common treatment method. Based on this, the effect of the doping ratio of La2O3, Fe2O3, and Al2O3 on the fluoride-removal performance was discussed by constructing a phase diagram. In this study, the adsorption mechanism of nanocrystalline lanthanum oxide terpolymer was investigated by density functional theory calculation and experiment. The optimal pH condition selected in the experiment was three, and the adsorption kinetics of fluoride ions were more consistent with the quasi-second-order kinetic model. The adsorption thermodynamics was more consistent with the Langmuir model. When the La-Fe-Al ternary composite oxides achieved the optimal adsorption efficiency for fluoride ions, the mass synthesis ratio was Al2O3:(Fe2O3:La2O3 = 1:2) = 1:100, resulting in a fluoride ion removal rate of up to 99.78%. Density functional calculations revealed that the La-Fe-Al ternary composite oxides had three important adsorption sites for La, Fe, and Al. Among them, the adsorption capacity for HF was Fe2O3 > La2O3 > Al2O3, and for F- was La2O3 > Al2O3 > Fe2O3. This provided good guidance for designing adsorbents to remove fluoride.

Huangqin decoction attenuates spared nerve injury (SNI)-induced neuropathic pain by modulating microglial M1/M2 polarization partially mediated by intestinal nicotinamide metabolism.

BACKGROUND: The incidence of neuropathic pain is progressively increasing over time. The activation of M1-type microglia plays a crucial role in the initiation and progression of neuropathic pain. Huangqin Decoction (HQD) is traditionally used to alleviate dysentery and abdominal pain. However, it remains unclear whether HQD can effectively mitigate neuropathic pain and the underlying mechanisms. PURPOSE: The present study aims to investigate the impact of HQD on neuropathic pain induced by spared nerve injury (SNI) in mice, and to elucidate whether the analgesic effect of HQD is associated with microglia polarization. METHODS: The analgesic effect of HQD on SNI mice was investigated through assessments of mechanical pain threshold, thermal pain threshold, cold pain threshold, and motor ability. We elucidated the molecular mechanisms of HQD in alleviating SNI-induced neuropathic pain by focusing on microglia polarization and intestinal metabolite abnormalities. The expression levels of markers associated with microglia polarization (Iba-1, CD68, CD206, iNOS) was detected by immunofluorescence and Western blot, and the levels of inflammatory factors (IL-4, IL-10, IL-6, TNF-α) were assessed by ELISA. UPLC-QTOF-MS metabolomics was utilized to identify differential metabolites in the intestines of SNI mice. We screened the differential metabolites related to microglial polarization by correlation analysis, subsequently nicotinamide was selected for validation in LPS-induced BV-2 cells. RESULTS: Our findings demonstrated that HQD (20 g/kg) significantly enhanced the mechanical pain threshold, thermal pain threshold, and cold pain threshold, and protected the injured DRG neurons of SNI mice. Moreover, HQD (20 g/kg) obviously suppressed the expression of microglia M1 polarization markers (Iba-1, CD68, iNOS, IL-6, TNF-α), and promoted the expression of microglia M2 polarization markers (CD206, IL-10, IL-4) in the spinal cord of SNI mice. Additionally, HQD (20 g/kg) prominently ameliorated intestinal barrier damage by upregulating Claudin 1 and Occludin expression in the colon of SNI mice. Furthermore, HQD (20 g/kg) rectified 19 metabolite abnormalities in the intestine. Notably, nicotinamide (100 µM), an amide derivative with anti-inflammatory property, effectively suppresses microglia activation and polarization in LPS-induced BV-2 cells by downregulating IL-6 level and CD68 expression while upregulating IL-4 level and CD206 expression. CONCLUSION: In summary, HQD alleviates neuropathic pain in SNI mice by regulating the activation and polarization of microglia, partially mediated through intestinal nicotinamide metabolism.

Functional analysis, diversity, and distribution of the ean cluster responsible for 17ß-estradiol degradation in sphingomonads.

17ß-estradiol (E2) is a natural endocrine disruptor that is frequently detected in surface and groundwater sources, thereby threatening ecosystems and human health. The newly isolated E2-degrading strain Sphingomonas colocasiae C3-2 can degrade E2 through both the 4,5-seco pathway and the 9,10-seco pathway; the former is the primary pathway supporting the growth of this strain and the latter is a branching pathway. The novel gene cluster ean was found to be responsible for E2 degradation through the 4,5-seco pathway, where E2 is converted to estrone (E1) by EanA, which belongs to the short-chain dehydrogenases/reductases (SDR) superfamily. A three-component oxygenase system (including the P450 monooxygenase EanB1, the small iron-sulfur protein ferredoxin EanB2, and the ferredoxin reductase EanB3) was responsible for hydroxylating E1 to 4-hydroxyestrone (4-OH-E1). The enzymatic assay showed that the proportion of the three components is critical for its function. The dioxygenase EanC catalyzes ring A cleavage of 4-OH-E1, and the oxidoreductase EanD is responsible for the decarboxylation of the ring A-cleavage product of 4-OH-E1. EanR, a TetR family transcriptional regulator, acts as a transcriptional repressor of the ean cluster. The ean cluster was also found in other reported E2-degrading sphingomonads. In addition, the novel two-component monooxygenase EanE1E2 can open ring B of 4-OH-E1 via the 9,10-seco pathway, but its encoding genes are not located within the ean cluster. These results refine research on genes involved in E2 degradation and enrich the understanding of the cleavages of ring A and ring B of E2.IMPORTANCESteroid estrogens have been detected in diverse environments, ranging from oceans and rivers to soils and groundwater, posing serious risks to both human health and ecological safety. The United States National Toxicology Program and the World Health Organization have both classified estrogens as Group 1 carcinogens. Several model organisms (proteobacteria) have established the 4,5-seco pathway for estrogen degradation. In this study, the newly isolated Sphingomonas colocasiae C3-2 could degrade E2 through both the 4,5-seco pathway and the 9,10-seco pathway. The novel gene cluster ean (including eanA, eanB1, eanC, and eanD) responsible for E2 degradation by the 4,5-seco pathway was identified; the novel two-component monooxygenase EanE1E2 can open ring B of 4-OH-E1 through the 9,10-seco pathway. The TetR family transcriptional regulator EanR acts as a transcriptional repressor of the ean cluster. The cluster ean was also found to be present in other reported E2-degrading sphingomonads, indicating the ubiquity of the E2 metabolism in the environment.

Artificial Domain Patterning in Ultrathin Ferroelectric Films via Modifying the Surface Electrostatic Boundary Conditions.

Nanoscale spatially controlled modulation of the properties of ferroelectrics via artificial domain pattering is crucial to their emerging optoelectronics applications. New patterning strategies to achieve high precision and efficiency and to link the resultant domain structures with device functionalities are being sought. Here, we present an epitaxial heterostructure of SrRuO3/PbTiO3/SrRuO3, wherein the domain configuration is delicately determined by the charge screening conditions in the SrRuO3 layer and the substrate strains. Chemical etching of the top SrRuO3 layer leads to a transition from in-plane a domains to out-of-plane c domains, accompanied by a giant (>105) modification in the second harmonic generation response. The modulation effect, coupled with the plasmonic resonance effect from SrRuO3, enables a highly flexible design of nonlinear optical devices, as demonstrated by a simulated split-ring resonator metasurface. This domain patterning strategy may be extended to more thin-film ferroelectric systems with domain stabilities amenable to electrostatic boundary conditions.

Ubiquitinome Analysis Uncovers Alterations in Synaptic Proteins and Glucose Metabolism Enzymes in the Hippocampi of Adolescent Mice Following Cold Exposure.

Cold exposure exerts negative effects on hippocampal nerve development in adolescent mice, but the underlying mechanisms are not fully understood. Given that ubiquitination is essential for neurodevelopmental processes, we attempted to investigate the effects of cold exposure on the hippocampus from the perspective of ubiquitination. By conducting a ubiquitinome analysis, we found that cold exposure caused changes in the ubiquitination levels of a variety of synaptic-associated proteins. We validated changes in postsynaptic density-95 (PSD-95) ubiquitination levels by immunoprecipitation, revealing reductions in both the K48 and K63 polyubiquitination levels of PSD-95. Golgi staining further demonstrated that cold exposure decreased the dendritic-spine density in the CA1 and CA3 regions of the hippocampus. Additionally, bioinformatics analysis revealed that differentially ubiquitinated proteins were enriched in the glycolytic, hypoxia-inducible factor-1 (HIF-1), and 5'-monophosphate (AMP)-activated protein kinase (AMPK) pathways. Protein expression analysis confirmed that cold exposure activated the mammalian target of rapamycin (mTOR)/HIF-1α pathway. We also observed suppression of pyruvate kinase M2 (PKM2) protein levels and the pyruvate kinase (PK) activity induced by cold exposure. Regarding oxidative phosphorylation, a dramatic decrease in mitochondrial respiratory-complex I activity was observed, along with reduced gene expression of the key subunits NADH: ubiquinone oxidoreductase core subunit V1 (Ndufv1) and Ndufv2. In summary, cold exposure negatively affects hippocampal neurodevelopment and causes abnormalities in energy homeostasis within the hippocampus.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Unlocking the potential: A novel prognostic index signature for acute myeloid leukemia.

Acute myeloid leukemia (AML) is an aggressive malignancy characterized by challenges in treatment, including drug resistance and frequent relapse. Recent research highlights the crucial roles of tumor microenvironment (TME) in assisting tumor cell immune escape and promoting tumor aggressiveness. This study delves into the interplay between AML and TME. Through the exploration of potential driver genes, we constructed an AML prognostic index (AMLPI). Cross-platform data and multi-dimensional internal and external validations confirmed that the AMLPI outperforms existing models in terms of areas under the receiver operating characteristic curves, concordance index values, and net benefits. High AMLPIs in AML patients were indicative of unfavorable prognostic outcomes. Immune analyses revealed that the high-AMLPI samples exhibit higher expression of HLA-family genes and immune checkpoint genes (including PD1 and CTLA4), along with lower T cell infiltration and higher macrophage infiltration. Genetic variation analyses revealed that the high-AMLPI samples associate with adverse variation events, including TP53 mutations, secondary NPM1 co-mutations, and copy number deletions. Biological interpretation indicated that ALDH2 and SPATS2L contribute significantly to AML patient survival, and their abnormal expression correlates with DNA methylation at cg12142865 and cg11912272. Drug response analyses revealed that different AMLPI samples tend to have different clinical selections, with low-AMLPI samples being more likely to benefit from immunotherapy. Finally, to facilitate broader access to our findings, a user-friendly and publicly accessible webserver was established and available at http://bioinfor.imu.edu.cn/amlpi. This server provides tools including TME-related AML driver genes mining, AMLPI construction, multi-dimensional validations, AML patients risk assessment, and figures drawing.

Treatment of Syringomyelia Characterized by Focal Dilatation of the Central Canal Using Mesenchymal Stem Cells and Neural Stem Cells.

BACKGROUND: Syringomyelia is a progressive chronic disease that leads to nerve pain, sensory dissociation, and dyskinesia. Symptoms often do not improve after surgery. Stem cells have been widely explored for the treatment of nervous system diseases due to their immunoregulatory and neural replacement abilities. METHODS: In this study, we used a rat model of syringomyelia characterized by focal dilatation of the central canal to explore an effective transplantation scheme and evaluate the effect of mesenchymal stem cells and induced neural stem cells for the treatment of syringomyelia. RESULTS: The results showed that cell transplantation could not only promote syrinx shrinkage but also stimulate the proliferation of ependymal cells, and the effect of this result was related to the transplantation location. These reactions appeared only when the cells were transplanted into the cavity. Additionally, we discovered that cell transplantation transformed activated microglia into the M2 phenotype. IGF1-expressing M2 microglia may play a significant role in the repair of nerve pain. CONCLUSION: Cell transplantation can promote cavity shrinkage and regulate the local inflammatory environment. Moreover, the proliferation of ependymal cells may indicate the activation of endogenous stem cells, which is important for the regeneration and repair of spinal cord injury.

A LATS2 and ALKBH5 positive feedback loop supports their oncogenic roles.

N(6)-methyladenosine (m6A) critically regulates RNA dynamics in various biological processes. The m6A demethylase ALKBH5 promotes tumorigenesis of glioblastoma, while the intricate web that orchestrates its regulation remains enigmatic. Here, we discover that cell density affects ALKBH5 subcellular localization and m6A dynamics. Mechanistically, ALKBH5 is phosphorylated by the large tumor suppressor kinase 2 (LATS2), preventing its nuclear export and enhancing protein stability. Furthermore, phosphorylated ALKBH5 reciprocally erases m6A from LATS2 mRNA, thereby stabilizing this transcript. Unexpectedly, LATS2 depletion suppresses glioblastoma stem cell self-renewal independent of yes-associated protein activation. Additionally, deficiency in either LATS2 or ALKBH5 phosphorylation impedes tumor progression in mouse xenograft models. Moreover, high levels of LATS2 expression and ALKBH5 phosphorylation are associated with tumor malignancy in patients with gliomas. Collectively, our study unveils an oncogenic positive feedback loop between LATS2 and ALKBH5, revealing a non-canonical branch of the Hippo pathway for RNA processing and suggesting potential anti-cancer interventions.

Research on the role and mechanism of IL-17 in intervertebral disc degeneration.

Intervertebral disc degeneration (IDD) is one of the primary causes of low back pain (LBP), which seriously affects patients' quality of life. In recent years, interleukin (IL)-17 has been shown to be highly expressed in the intervertebral disc (IVD) tissues and serum of patients with IDD, and IL-17A has been shown to promote IDD through multiple pathways. We first searched databases such as PubMed, Cochrane, Embase, and Web of Science using the search terms "IL-17 or interleukin 17″ and "intervertebral discs". The search period ranged from the inception of the databases to December 2023. A total of 24 articles were selected after full-text screening. The main conclusion of the clinical studies was that IL-17A levels are significantly increased in the IVD tissues and serum of IDD patients. The results from the in vitro studies indicated that IL-17A can activate signaling pathways such as the NF-κB and MAPK pathways; promote inflammatory responses, extracellular matrix degradation, and angiogenesis; and inhibit autophagy in nucleus pulposus cells. The main finding of the in vivo experiments was that puncture of animal IVDs resulted in elevated levels of IL-17A within the IVD, thereby inducing IDD. Clinical studies, in vitro experiments, and in vivo experiments confirmed that IL-17A is closely related to IDD. Therefore, drugs that target IL-17A may be novel treatments for IDD, providing a new theoretical basis for IDD therapy.

Can the heptapeptide ASSIVSF of the ß2-adrenoceptor recognize ephedrine and pseudoephedrine epimers in a complex system?

Epimer separation is crucial in the field of analytical chemistry, separation science, and the pharmaceutical industry. No reported methods could separate simultaneously epimers or even isomers and remove other unwanted, co-existing, interfering substances from complex systems like herbal extracts. Herein, we prepared a heptapeptide-modified stationary phase for the separation of 1R,2S-(-)-ephedrine [(-)-Ephe] and 1S,2S-(+)-pseudoephedrine [(+)-Pse] epimers from Ephedra sinica Stapf extract and blood samples. The heptapeptide stationary phase was comprehensively characterized by scanning electron microscopy, X-ray photoelectron spectroscopy, and Fourier transform infrared spectroscopy. The separation efficiency of the heptapeptide column was compared with an affinity column packed with full-length ß2-AR functionalized silica gel (ß2-AR column). The binding affinity of the heptapeptide with (+)-Pse was 3-fold greater than that with (-)-Ephe. Their binding mechanisms were extensively characterized by chromatographic analysis, ultraviolet spectra, circular dichroism analysis, isothermal titration calorimetry, and molecule docking. An enhanced hydrogen bonding was clearly observed in the heptapeptide-(+)-Pse complex. Such results demonstrated that the heptapeptide can recognize (+)-Pse and (-)-Ephe epimers in a complex system. This work, we believe, was the first report to simultaneously separate epimers and remove non-specific interfering substances from complex samples. The method was potentially applicable to more challenging sample separation, such as chiral separation from complex systems.

DNA Framework-Engineered Assembly of Cyanine Dyes for Structural Identification of Nucleic Acids.

DNA nanostructures serve as precise templates for organizing organic dyes, enabling the creation of programmable artificial photonic systems with efficient light-harvesting and energy transfer capabilities. However, regulating the organization of organic dyes on DNA frameworks remains a great challenge. In this study, we investigated the factors influencing the self-assembly behavior of cyanine dye K21 on DNA frameworks. We observed that K21 exhibited diverse assembly modes, including monomers, H-aggregates, J-aggregates, and excimers, when combined with DNA frameworks. By manipulating conditions such as the ion concentration, dye concentration, and structure of DNA frameworks, we successfully achieved precise control over the assembly modes of K21. Leveraging K21's microenvironment-sensitive fluorescence properties on DNA nanostructures, we successfully discriminated between the chirality and topology structures of physiologically relevant G-quadruplexes. This study provides valuable insights into the factors influencing the dynamic assembly behavior of organic dyes on DNA framework nanostructures, offering new perspectives for constructing functional supramolecular aggregates and identifying DNA secondary structures.

Effect of butylphthalide on prevention and treatment of high altitude cerebral edema in rats.

3-n-butylphthalide (NBP) contains one of the main active ingredients of celery seed. It has a series of pharmacological mechanisms, including reconstitution of microcirculation, protection of mitochondrial function, inhibition of oxidative stress, and inhibition of neuronal apoptosis. Based on the complex multi-targeting of NBP pharmacological mechanisms, the clinical applications of NBP are increasing, and more and more clinical studies and animal experiments have focused on NBP. In this study, we used male Sprague Dawley rats as an animal model to elucidate the intervention effect of butylphthalide on high altitude cerebral edema (HACE), and also compared the effect of butylphthalide and rhodiola rosea on HACE. Firstly, we measured the changes of body weight and brain water content and observed the pathological changes of brain tissues. In addition, the contents of inflammatory factors, oxidative stress and brain neurotransmitters were assessed by enzyme-linked immunoassay kits, and finally, the expression of apoptotic proteins in brain tissues was determined by western blotting. The results showed that NBP reduced brain water content, attenuated brain tissue damage, altered inflammatory factors, oxidative stress indicators, and brain neurotransmitter levels, and in addition NBP inhibited the expression of Caspase-related apoptotic proteins. Therefore, NBP has the potential to treat and prevent HACE.

Hypomethylation-associated LINC00987 downregulation induced lung adenocarcinoma progression by inhibiting the phosphorylation-mediated degradation of SND1.

DNA methylation, an epigenetic regulatory mechanism dictating gene transcription, plays a critical role in the occurrence and development of cancer. However, the molecular underpinnings of LINC00987 methylation in the regulation of lung adenocarcinoma (LUAD) remain elusive. This study investigated LINC00987 expression in LUAD patients through analysis of The Cancer Genome Atlas data sets. Quantitative real-time polymerase chain reaction (RT-qPCR) and fluorescence in situ hybridization assays were used to assess LINC00987 expression in LUAD. The bisulfite genomic sequence PCR (BSP) assay was used to determine the methylation levels of the LINC00987 promoter. The interaction between LINC00987 and SND1 was elucidated via immunoprecipitation and RNA pull-down assays. The functional significance of LINC00987 and SND1 in Calu-3 and NCI-H1688 cells was evaluated in vitro through CCK-8, EdU, Transwell, flow cytometry, and vasculogenic mimicry (VM) tube formation assays. LINC00987 expression decreased in LUAD concomitant with hypermethylation of the promoter region, while hypomethylation of the LINC00987 promoter in LUAD tissues correlated with tumor progression. Treatment with 5-Aza-CdR augmented LINC00987 expression and inhibited tumor growth. Mechanistically, LINC00987 overexpression impeded LUAD progression and VM through direct binding with SND1, thereby facilitating its phosphorylation and subsequent degradation. Additionally, overexpression of SND1 counteracted the adverse effects of LINC00987 downregulation on cell proliferation, apoptosis, cell migration, invasion, and VM in LUAD in vitro. In conclusion, this pioneering study focuses on the expression and function of LINC00987 and reveals that hypermethylation of the LINC00987 gene may contribute to LUAD progression. LINC00987 has emerged as a potential tumor suppressor gene in tumorigenesis through its binding with SND1 to facilitate its phosphorylation and subsequent degradation.

Autophagy receptor ZmNBR1 promotes the autophagic degradation of ZmBRI1a and enhances drought tolerance in maize.

Drought stress is a crucial environmental factor that limits plant growth, development, and productivity. Autophagy of misfolded proteins can help alleviate the damage caused in plants experiencing drought. However, the mechanism of autophagy-mediated drought tolerance in plants remains largely unknown. Here, we cloned the gene for a maize (Zea mays) selective autophagy receptor, NEXT TO BRCA1 GENE 1 (ZmNBR1), and identified its role in the response to drought stress. We observed that drought stress increased the accumulation of autophagosomes. RNA sequencing and reverse transcription-quantitative polymerase chain reaction showed that ZmNBR1 is markedly induced by drought stress. ZmNBR1 overexpression enhanced drought tolerance, while its knockdown reduced drought tolerance in maize. Our results established that ZmNBR1 mediates the increase in autophagosomes and autophagic activity under drought stress. ZmNBR1 also affects the expression of genes related to autophagy under drought stress. Moreover, we determined that BRASSINOSTEROID INSENSITIVE 1A (ZmBRI1a), a brassinosteroid receptor of the BRI1-like family, interacts with ZmNBR1. Phenotype analysis showed that ZmBRI1a negatively regulates drought tolerance in maize, and genetic analysis indicated that ZmNBR1 acts upstream of ZmBRI1a in regulating drought tolerance. Furthermore, ZmNBR1 facilitates the autophagic degradation of ZmBRI1a under drought stress. Taken together, our results reveal that ZmNBR1 regulates the expression of autophagy-related genes, thereby increasing autophagic activity and promoting the autophagic degradation of ZmBRI1a under drought stress, thus enhancing drought tolerance in maize. These findings provide new insights into the autophagy degradation of brassinosteroid signaling components by the autophagy receptor NBR1 under drought stress.